9 de dezembro de 2010

MJM 702: Exercícios de Recuperação

Escola: MJM.  Turma: 702.
Lista de Exercícios para recuperação
Formatos: online, imagem (jpg) e para baixar (em pdf)
Para ver as respostas: http://fwd4.me/LI9


PREZADO ALUNO,
Você tem 4 opções para ter acesso e utilizar a lista de exercícios: 
- baixar do site 4shared, 
- baixar do site XPG, 
- ver no formato jpg (imagem), 
- ler online aqui no blog, (nest mesmo post, logo mais abaixo).
..............

Para baixar e imprimir a lista de exercícios (no site 4shared):
http://www.4shared.com/document/s1AVuvVo/MJM2010B4702ex-recuperacao.html

Para baixar e imprimir a lista de exercícios (no site XPG):
http://www.sciencerockcaffe.xpg.com.br/escolas/MJM,2010,B4,702,ex-rec.pdf

..............

Para consultar no formato jpg (imagem), basta clicar nas figuras abaixo:
(Cada figura corresponte a uma página da lista)




..............
LISTA DE EXERCÍCIOS:

1) Do que é feita toda a matéria que existe no Universo?

2) O que são átomos?

3) O que são moléculas?

4) Dê o nome das moléculas apontadas abaixo:

H2O
CO2
O2
NH3
CH4
C6H12O6

5) Dê a fórmula das moléculas indicadas abaixo:

Água
Gás Oxigênio
Glicose
Gás Carbônico
Gás Metano
Amônia

6) Desenhe a fórmula espacial e modelo espacial das moléculas de água, gás oxigênio, amônia, gás carbônico e gás metano:

7) O que é uma biomolécula?

8) Quais são os 4 principais tipos de biomoléculas?

9) Qual é a função principal dos carboidratos?

10) Qual é o carboidrato mais utilizado como combustível nos seres vivos?

11) Qual carboidrato é utilizado como reserva de energia nos vegetais?

12) Qual carboidrato é utilizado como reserva de energia e fica no fígado dos animais?

13) Qual carboidrato nós, humanos, não conseguimos digerir e é utilizado para fazer papel?

14) Qual é o nome do carboidrato branco, utilizado no dia-a-dia para temperar café, refrescos e sucos?

15) Quando eu falo de “carboidratos” eu quero dizer:

( ) Gorduras ( ) Açúcares
( ) Vitaminas ( ) Proteínas

16) Quais são as 3 principais funções dos lipídios?

11) Os lipídios guardam duas vezes mais energia que os carboidratos, mesmo assim não são utilizadas diretamente como combustível. Por quê?

15) Quando eu falo de “lipídios” eu quero dizer:

( ) Gorduras ( ) Açúcares
( ) Vitaminas ( ) Proteínas

16) O colesterol é um lipídio importante para:

( ) Produção de vitaminas
( ) Produção de energia
( ) Produção de hormônios
( ) Construção da membrana celular
( ) Construção do DNA.

17) O que são proteínas?

18) O que são enzimas?

19) O que fazem as enzimas?

20) Para que servem as proteínas estruturais?

21) Qual é a relação entre o DNA e as proteínas?

22) Qual tipo de biomoléculas é capaz de guardar informações?

23) Quais são os dois principais ácidos nucléicos?

24) O que é gene?

25) O que é cromossomo?

26) O que é genoma?

27) Que tipo de informação está guardada nos genes?

28) Compare e Associe:

1.DNA; 2. Cromossomo; 3. Gene; 4.Genoma; 5.Proteínas.

( ) Coleção de CDs
( ) Plástico de que é feito o CD
( ) Arquivo da música gravada
( ) Música sendo tocada
( ) CD com músicas gravadas

29) O código genético é constituído por 4 “letras”. Que letras são estas?

30) Qual é a diferença entre o código genético no DNA e no RNA?

31) Complete as moléculas de DNA:

a) ATCCTAGGCTAAAT
b) TTTCCAAGGAATCC
c) ATTACCGGGGCCTT

32) Monte moléculas de RNA a partir do DNA fornecido:

a) ATCCTAGGCTAAAT
b) TTTCCAAGGAATCC
c) ATTACCGGGGCCTT

33) As “letras” (bases) do RNA se organizam em “palavras” (códons). Quantas bases tem um códon?

34) Quantos códons diferentes existem?

35) O que é transcrição?

36) O que é tradução?

37) O que é síntese protéica?

38) Onde ocorre a transcrição?

39) Onde ocorre a tradução?

40) Como ocorre a tradução?

41) Faça um esquema demonstrando todo o processo da síntese protéica:

42) Complete: Cada gene guarda a receita para fabricar _______.

43) O que o DNA tem a ver com a cor dos olhos, da pele ou do cabelo?

44) Onde são guardadas as informações para a construção e funcionamento do seu corpo?

45) Faça a transcrição dos trechos de DNA abaixo:

a) TTTCCCAAAGCGTAT
b) CGCAATTTAGCGGGG
c) CCCAAATTTGGGAAA

46) Utilize a tabela VERDADEIRA de aminoácidos e traduza o trecho de RNA abaixo:

GUAUUUAUGAAAAAGCGCCUUUCUAUAGUAGUUAUCCUACGAAAGUGAAACCAAGUA

47) Utilize a tabela falsa de aminoácidos (pseudocódons), traduza o trecho de RNA a seguir e descubra a mensagem:

UUUAAAAUGAUUCAGAAUAAGCUAUUUCAUAUACCAAUCGAUUUCAUAUUCGCCAUACAAAAACUCAUCCAGCAAGCUUAGUUUAAA

48) Quais são as 4 regiões que uma célula pode ter?

49) Quantas e quais regiões possuem as células abaixo:

a) Célula procarionte
b) Célula animal
c) Célula fúngica
d) Célula vegetal

50) Dê as funções das estruturas celulares abaixo:

a) Membrana Celular
b) Citoplasma
c) Núcleo
d) Ribossomos
e) Complexo de Golgi
f) Mitocôndrias

51) Que tipo de biomolécula é feita de aminoácidos?

52) Quantos tipos de aminoácidos existem na natureza?

53) Qual estrutura seleciona o que entra e sai da célula?

54) Qual organela fabrica proteínas?

55) Em que parte da célula ocorre a maior parte do metabolismo?

56) Qual organela queima glicose para gerar energia?

57) Nas células eucariontes, onde fica o DNA?

58) E nas células procariontes?

59) Qual é a principal diferença entre uma célula procarionte e uma célula eucarionte?

60) Classifique os seres vivos abaixo como eucariontes (EU) ou procariontes (PRO):

Ser Vivo: ( )Procarionte ( )Eucarionte
Cachorro - ( )Procarionte ( )Eucarionte
Mangueira - ( )Procarionte ( )Eucarionte
Bactéria - ( )Procarionte ( )Eucarionte
Cianobactéria - ( )Procarionte ( )Eucarionte
Cogumelo - ( )Procarionte ( )Eucarionte
Formiga - ( )Procarionte ( )Eucarionte

61) Qual é o tipo de ser vivo possui células sem parede celular?

62) Por que dizemos que os fungos são mais próximos dos animais do que das plantas?

63) Qual é o nome da molécula que leva informações do DNA até os ribossomos?

64) Qual nome damos às “proteínas operárias” das células?

65) Qual é o nome do carboidrato de reserva presente no trigo, na batata e nas massas?

67) Qual é a unidade fundamental do corpo e da vida?

68) Qual é o nome do conjunto total de genes de um ser vivo?

69) O que é um gene?

70) O que é um cromossomo?

71) O que é DNA?

72) O que é um Ser Procarionte?

73) O que é um Ser Eucarionte?

74) Quais são os seres viventes mais antigos conhecidos?

75) Há quanto tempo eles existem?

76) Como sabemos que eles existiam no passado distante?

77) Como podemos conhecer seres vivos que não existem mais há milhões de anos?

78) Há quanto tempo existe vida no planeta Terra?

79) Qual é a idade aproximada do planeta Terra?

80) No início da vida só existiam bactérias e cianobactérias. Como estes seres evoluíram e deram origem a todos os seres vivos que existem hoje?

81) Desenhe e nomeie todas as estruturas de uma célula bacteriana.

82) Cite 3 doenças bacterianas:

83) Cite 3 funções ecológicas cumpridas por bactérias e cianobactérias?

84) Poderíamos viver em um mundo sem bactérias? Explique sua resposta.

85) Quais são os 6 reinos da vida?

86) Desenhe e nomeie as estruturas de uma célula fúngica:

87) O que são hifas?

88) O que são micélios?

89) O que é uma flor?

90) O que é uma planta angiosperma? Dê 3 exemplos.

91) Qual é a função da flor?

92) Qual é o nome do órgão sexual masculino da planta?

93) Qual é o nome do órgão sexual feminino da planta?

94) Qual é o nome da estrutura que produz e armazena o pólen?

95) Qual é o nome da estrutura que produz e armazena os óvulos da flor?

96) Qual é o órgão floral reponsável por atrair animais polinizadores?

97) O que acontece com o óvulo (da planta) depois que é fecundado?

98) Relacione o órgão com o seu conjunto:

Conjuntos:
1.Gineceu; 2.Androceu; 3.Corola; 4.Cálice; 5. Não têm!

( ) Carpelos
( ) Pedúnculos
( ) Receptáculos
( ) Estames
( ) Sépalas
( ) Pétalas

99) Para que servem as sépalas?

100) Para que servem as pétalas?

101) Qual é a função dos carpelos?

102) Qual é a função dos estames?

103) Para que serve o pedúnculo?

104) Qual é a função do receptáculo floral?

105) O que acontece com o ovário da planta depois que seus óvulos são fecundados?

106) Como surgem as sementes?

107) Como surgem os frutos?

108) Como surgem os pseudofrutos?

109) Qual estrutura dá origem à semente?

110) Um carpelo teve 20 óvulos fecundados. Ele vai se modificar para dar origem a um fruto. Quantas sementes ele terá?

111) A banana tem sementes? O que são aqueles pontinhos pretos?

112) Como é polinizada uma flor sem cor, sem cheiro e sem atrativos (como a do trigo)?

113) Flores brancas, noturnas e muito cheirosas são polinizadas por:

( ) Beija-Flores
( ) Abelhas
( ) Mariposas
( ) Borboletas
( ) Morcegos
( ) Moscas

114) Flores diurnas, coloridas e cheias de néctar são polinizadas por:

( ) Beija-Flores
( ) Abelhas
( ) Mariposas
( ) Borboletas
( ) Morcegos
( ) Moscas


115) Flores vermelho-amarronzadas, com cheiro de carne podre são polinizadas por:

( ) Beija-Flores
( ) Abelhas
( ) Mariposas
( ) Borboletas
( ) Morcegos
( ) Moscas

116) Que materiais caseiros podemos utilizar para montar um meio de cultura de bactérias?

117) Como podemos medir a área ocupada por uma colônia de fungos ou de bactérias em uma placa?

118) O que é um pseudo-fruto? Dê 3 exemplos:

119) Desenhe e nomeie um fruto completo, com suas 4 estruturas principais:

120) Observe o desenho abaixo e nomeie todas as estruturas apontadas:

- A:___________________
- B:___________________
- Bx:__________________
- C:___________________
- D:___________________
- E:___________________




121) Desenhe e nomeie um Carpelo, mostrando estigmas, tubo polínico, ovário e óvulos.

122) Desenhe e nomei um Estame, mostrando Anteras e filetes.

123) Qual é a função das Anteras?


OBS: Além dos exercícios desta lista, vão cair os exercícios da página 140 do livro.

Nenhum comentário:

Postar um comentário

Deixe aqui sua dúvida, pergunta, comentário ou opinião. Conforme a disponibilidade de tempo, tentaremos responder a todos.

 
/* google analytics */